View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7033_low_32 (Length: 233)
Name: NF7033_low_32
Description: NF7033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7033_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 212
Target Start/End: Complemental strand, 55378113 - 55377905
Alignment:
| Q |
5 |
gatggacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378113 |
gatggacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
55378014 |
T |
 |
| Q |
105 |
gtacactatactataactagatatt-ttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378013 |
gtacactatactataactagatatttttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
55377914 |
T |
 |
| Q |
204 |
taaaagaga |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
55377913 |
taaaagaga |
55377905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University