View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7034_high_6 (Length: 242)
Name: NF7034_high_6
Description: NF7034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7034_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 22278305 - 22278085
Alignment:
| Q |
6 |
gtatggtggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgtctgtggcgaggt |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22278305 |
gtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgtctgtggcgaggt |
22278206 |
T |
|
| Q |
106 |
acgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtcggttttcagggagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278205 |
acgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtcggttttcagggagg |
22278106 |
T |
|
| Q |
206 |
gagttggtttaatgagaatgt |
226 |
Q |
| |
|
|||||| || ||||||||||| |
|
|
| T |
22278105 |
gagttgattcaatgagaatgt |
22278085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 226
Target Start/End: Complemental strand, 20562800 - 20562728
Alignment:
| Q |
154 |
gttggtggaaagatatcgtgaggattcgtgatgatgtcggttttcagggagggagttggtttaatgagaatgt |
226 |
Q |
| |
|
|||||||||| ||||| | |||||||| |||| ||| | |||| ||||||||||||||||| | |||||||| |
|
|
| T |
20562800 |
gttggtggaaggatatggggaggattcaggatggtgttgattttgagggagggagttggtttgaggagaatgt |
20562728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University