View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7034_low_7 (Length: 242)

Name: NF7034_low_7
Description: NF7034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7034_low_7
NF7034_low_7
[»] chr7 (2 HSPs)
chr7 (6-226)||(22278085-22278305)
chr7 (154-226)||(20562728-20562800)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 22278305 - 22278085
Alignment:
6 gtatggtggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgtctgtggcgaggt 105  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
22278305 gtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgtctgtggcgaggt 22278206  T
106 acgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtcggttttcagggagg 205  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22278205 acgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtcggttttcagggagg 22278106  T
206 gagttggtttaatgagaatgt 226  Q
    |||||| || |||||||||||    
22278105 gagttgattcaatgagaatgt 22278085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 226
Target Start/End: Complemental strand, 20562800 - 20562728
Alignment:
154 gttggtggaaagatatcgtgaggattcgtgatgatgtcggttttcagggagggagttggtttaatgagaatgt 226  Q
    |||||||||| ||||| | ||||||||  |||| ||| | |||| ||||||||||||||||| | ||||||||    
20562800 gttggtggaaggatatggggaggattcaggatggtgttgattttgagggagggagttggtttgaggagaatgt 20562728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University