View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_high_14 (Length: 276)
Name: NF7035_high_14
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 9 - 155
Target Start/End: Original strand, 20673954 - 20674100
Alignment:
| Q |
9 |
tcgtgttgtcaatgactttttcaactataattttgggtttctttcttgaatctgaatccatttgccgttgcccctcatattttccaccgtcagatgtaca |
108 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
20673954 |
tcgtggtgtcaatgactttttcaactacaattttgggtttctttcttgaatctgaatccatttgctgttgcccctcatattttccactgtcagatgtaca |
20674053 |
T |
|
| Q |
109 |
agaattgtgaacattcctagagcatgatgaaacttctgtcttcacaa |
155 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20674054 |
aggattgtgaacattcctagagcatgatgaaacttctgtcttcacaa |
20674100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 152 - 276
Target Start/End: Original strand, 20674127 - 20674251
Alignment:
| Q |
152 |
acaatttccatgttgtcttcttccttttttatctttgaacaacatgctttttcctctactgaatcacccttgttatggctatctgcaatatccaccttat |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20674127 |
acaatttccatgttgtcttgttccttttttatctttgaacaacatgctttttcctctactgaatcacccttgttatggctatctgcaatatcgaccttat |
20674226 |
T |
|
| Q |
252 |
ctttgtctatgacgatcatattgtc |
276 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
20674227 |
ctttgtctacgacgatcatattgtc |
20674251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University