View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_high_26 (Length: 228)
Name: NF7035_high_26
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 8 - 216
Target Start/End: Complemental strand, 42239712 - 42239503
Alignment:
| Q |
8 |
gcagaacctgtgtgcatctacaatacaagagagttttcaagtaattggtgcaattggcacgcaatagagcatta------agtaagtgaaataaattgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42239712 |
gcagaacctgtgtgcatctacaatacaagagagtgttcaagtaattggtgcaattggcgcgcaatagagcattatattcaagtaagtgaaataaattgtt |
42239613 |
T |
 |
| Q |
102 |
ttccttctcaactattgttgtaaatgatcaatgagatactgcatgctaactgtctatgtttggtacatatatgttttagtgcgaacaaagtagttttggt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42239612 |
ttccttctcaacttttgttgtaaatgatcaatgagatattgcatgctaac-----atgtttggtacatatatgttttagtgcgaacaaagtagttttggt |
42239518 |
T |
 |
| Q |
202 |
aggatgaagaaggtg |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42239517 |
aggatgaagaaggtg |
42239503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University