View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_high_28 (Length: 226)
Name: NF7035_high_28
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 27009496 - 27009706
Alignment:
| Q |
1 |
aaagaagagttacataaaaaacctttgaaatattatttgcagattgaatcaaaggatgttatgaaggaagattacaacaaggttctgaatgaattggagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27009496 |
aaagaagagttacataaaaaacctttgaaatattatttgcagattgaatcaaaggatgttatggaggaagattacaacaaggttctgaatgaattggagc |
27009595 |
T |
|
| Q |
101 |
aagttaagaaggaacatgaaaatgaaattgaagaacttatttacttgaggaagattaatgtttgtttaaggcaagagttaatgaaacatgaattgcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
27009596 |
aagttaagaaggaacatgaaaatgaaattgaagaacttatttacttgaggaagattaatgtttgtttaagccaagagttaatgaaccatgaattccattg |
27009695 |
T |
|
| Q |
201 |
ttcctttttgg |
211 |
Q |
| |
|
| ||||||||| |
|
|
| T |
27009696 |
tccctttttgg |
27009706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University