View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_high_31 (Length: 209)
Name: NF7035_high_31
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 413356 - 413529
Alignment:
| Q |
21 |
ttaatgttgctgctacataagcttcaactataaatttccaagatattgaataaattgcatgttgtaatgatagaaattgaaaatgcattgtggaattggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
413356 |
ttaatgttgctgctacataagcttcaactataaatttccaagatattgaataaattgcatgttgtaatgatagaaattgaaaatgcattgtggaattggt |
413455 |
T |
 |
| Q |
121 |
tggacatttgtaatgaacacaggattttcgagagctatatattgtaagtgattctttaaagtctattggtctct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
413456 |
tggacatttgtaatgaacacaggattttcaagagctatatattgtaagtgattctttaaagtctattggtctct |
413529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 98 - 149
Target Start/End: Complemental strand, 7430767 - 7430716
Alignment:
| Q |
98 |
tgaaaatgcattgtggaattggttggacatttgtaatgaacacaggattttc |
149 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
7430767 |
tgaaaatgtcttgtggaattggctggacatttgtaatgaacataggcttttc |
7430716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University