View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_high_6 (Length: 431)
Name: NF7035_high_6
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 18 - 423
Target Start/End: Complemental strand, 34381154 - 34380749
Alignment:
| Q |
18 |
tctttatcatcaatttttctgtaatatgaattgttggtttcttgaggaattgatcatttgcttcccatgcatactctcctggctttatttcaatagcaat |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381154 |
tctttatcatcaatttttctgcaatatgaattgttggtttcttgaggaattgatcatttgcttcccatgcatactctcctggctttatttcaatagcaat |
34381055 |
T |
 |
| Q |
118 |
tgttgaagttttggaagcatgcctattcatgaattgattttgatcttcttcctttatgaactcttggattcgatcgacagagacttttgtttgagttatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34381054 |
tgttgaagttttggaagcatgcctattcatgaattgattttgatcttcttcctttatgaactcttggattcgatcgacggagacttttgtttgagttatc |
34380955 |
T |
 |
| Q |
218 |
atggaaataagttcaggcaaattgtaaatcggttcttgcaaaatacgaaatgttgcaagagccgagaggactgtggctgcagttagctcggttttcacca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380954 |
atggaaataagttcaggcaaattgtaaatcggttcttgcaaaatacgaaatgttgcaagagccgagaggactgtggctgcagttagctcggttttcacca |
34380855 |
T |
 |
| Q |
318 |
atatacaagctccaaaagtgaaaacagaaaccaaagttggagatgcccaaaatagcgtggctactgctgagcataagtagaggtatttgtgcaaccactt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380854 |
atatacaagctccaaaagtgaaaacagaaaccaaagttggagatgcccaaaatagcgtggctactgctgagcataagtagaggtatttgtgcaaccactt |
34380755 |
T |
 |
| Q |
418 |
cttctc |
423 |
Q |
| |
|
|||||| |
|
|
| T |
34380754 |
cttctc |
34380749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University