View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_low_12 (Length: 310)
Name: NF7035_low_12
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 5 - 292
Target Start/End: Original strand, 7387091 - 7387380
Alignment:
| Q |
5 |
ggaacacatgtttgatgtgaagttcatctaag--tgtgtaggcttgtgacaaaatagtatttgtagtttcgtaattgatatcttatataaatactacggt |
102 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7387091 |
ggaacacatgtttgatgcgaagttcaactaagagtgtgtagacttgtgacaaaatagtatttgtagtttcgtaattgatgtcttatataaatactacggt |
7387190 |
T |
 |
| Q |
103 |
tcaaattacaacaatgcctcttaactatagcgtgaggacctatggcctccacatctccagtcacccctacaacaatcagttggacaaacacaatggtagg |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7387191 |
tcaaattacaataatgcctcttaactatagcgtgaggacctatggcctccacatctccggtcacccctacaacaatcagttggacaaacacaatggtagg |
7387290 |
T |
 |
| Q |
203 |
gccaaagctcactcctctcactcgtctcttattccattactatctataagccatactcaacaatctttacattgacgaatatcaaaccct |
292 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7387291 |
gccaaagctcgctcttctcacttgtctcttattccattactatctatgagccatattcaacaatctttacattgacgaatatcaaaccct |
7387380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University