View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_low_22 (Length: 247)
Name: NF7035_low_22
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 158 - 247
Target Start/End: Complemental strand, 37819141 - 37819052
Alignment:
| Q |
158 |
actctctaactagtttcactatagttgatggtgttcgtagttgggtcagtatgagaggtggtggtggtcgaattggtgatcgaagatggt |
247 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37819141 |
actctttaactagtttcactatagttgatggtgtttgtagttgggtcagtatgagaggtggtggtggtcgaattggtgatcgaagatggt |
37819052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University