View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_low_32 (Length: 213)
Name: NF7035_low_32
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 183
Target Start/End: Original strand, 7554466 - 7554641
Alignment:
| Q |
8 |
gagtgagatgaagacgaggcaagatcggaagttggcgatgacggtgccgaagtttaccgcagaggacggtggtgaaaagagttgctgggaacttatccgg |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554466 |
gagtgatatgaagacgaggcaagatcggaagttggcgatgacggtgccgaagtttaccgcagaggacggtggtgaaaagagttgctgggaacttatccgg |
7554565 |
T |
 |
| Q |
108 |
ccattacggcgtcggggaaagtttataagtaacttgaagtcatcctttagaattagatgcatttccattgcttagg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554566 |
ccattacggcgtcggggaaagtttataagtaacttgaagtcatcctttagaattagatgcatttccattgcttagg |
7554641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 8 - 183
Target Start/End: Original strand, 7544688 - 7544863
Alignment:
| Q |
8 |
gagtgagatgaagacgaggcaagatcggaagttggcgatgacggtgccgaagtttaccgcagaggacggtggtgaaaagagttgctgggaacttatccgg |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
7544688 |
gagtgatatgaagacgaggcaagatcggaagttggcgatgacggtgccgaagtttaccgcggaggacggtggtgaaaagagtttctgggaacttgtccgg |
7544787 |
T |
 |
| Q |
108 |
ccattacggcgtcggggaaagtttataagtaacttgaagtcatcctttagaattagatgcatttccattgcttagg |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
7544788 |
ccattacggcgtcggggaaagtttatgagtagcttgaagtcatcctttaaaattagatgcatatctattgcttagg |
7544863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University