View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7035_low_5 (Length: 463)
Name: NF7035_low_5
Description: NF7035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7035_low_5 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 37 - 459
Target Start/End: Complemental strand, 49825515 - 49825101
Alignment:
| Q |
37 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatatcnnnnnnnatattgtgatacgatcgtatttttatgcatgttggtaattt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
49825515 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatagcttttt---tattgtgatatgattgtatttttatgcatgttattaattt |
49825419 |
T |
|
| Q |
137 |
ggagtgcgtttcatttgatcagggtaaaccctcaagcgagcgagtatccaaatgaatttgatattgttgttggaaaacaaatgctatttaaggttggaat |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||| ||||| || |||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
49825418 |
ggagtgcgttttatttgatcagggtaaaccctcaagcgag----tatcccaatgagttggatatttttgttggaaaacaaatgctatttaaggttgaaat |
49825323 |
T |
|
| Q |
237 |
tacggatgggaacttaatgcataattggcgcaactatgcggtcaaaaggacatctgatgaatcaatttgtgactcttcacaacattacaatgacgaatat |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49825322 |
tacggatgggaacttaatgcataattggcgcaactatgctgtcaaaaggacatctgatgaatcaatttgtgactcttcacaacattacaatggcgaatat |
49825223 |
T |
|
| Q |
337 |
cctgctgatctggatttgttcatagacnnnnnnnntgttgtttaaagttgagataactgatggcaacttgaagcatggatggcgtaactaagctgtgaag |
436 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49825222 |
cctgctgatctggatttgttcatagac-aaaaaaatgttgtttaaagtcgagataactgatggcaacttgaagcatggatggcgtaactaagttgtgaag |
49825124 |
T |
|
| Q |
437 |
cgggtgtatgatgatgtccatct |
459 |
Q |
| |
|
||||||| |||||||||| |||| |
|
|
| T |
49825123 |
cgggtgtctgatgatgtcgatct |
49825101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 203 - 287
Target Start/End: Original strand, 232573 - 232658
Alignment:
| Q |
203 |
ttgttggaaaacaaatgctatttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
287 |
Q |
| |
|
|||||||||| ||||| | |||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
232573 |
ttgttggaaagaaaatgttgtttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
232658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 203 - 287
Target Start/End: Complemental strand, 14584802 - 14584717
Alignment:
| Q |
203 |
ttgttggaaaacaaatgctatttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
287 |
Q |
| |
|
|||||||||| ||||| | |||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
14584802 |
ttgttggaaagaaaatgttgtttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
14584717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University