View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7036_high_14 (Length: 264)
Name: NF7036_high_14
Description: NF7036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7036_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 32376046 - 32376282
Alignment:
| Q |
9 |
atcatagacaagacaaatgaactagaccaagttccatagtaaatcaaatgatgaaacaaatcatcttggaccatcctcaaaagtttagggtgattcccta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376046 |
atcatagacaagacaaatgaactagaccaagttccatagtaaatcaaatgatgaaacaaatcatcttggaccatcctcaaaagtttagggtgattcccta |
32376145 |
T |
 |
| Q |
109 |
tcttatcaccactcaattcaatagctgagttaatcaaaaccaaagcaaaaatctgaacatcttcatcagctgtatgagtagttgatccatctgcctcaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376146 |
tcttatcaccactcaattcaatagctgagttaatcaaaaccaaagcaaaaatctgaacatcttcatcagctgtatgagtagttgatccatctgcctcaac |
32376245 |
T |
 |
| Q |
209 |
tacagaaacaacattcaacaaagaacagagaaaatga |
245 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32376246 |
tacagaaacaacattcaacaaagaacacagaaaatga |
32376282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University