View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7036_low_12 (Length: 299)
Name: NF7036_low_12
Description: NF7036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7036_low_12 |
 | |
|
| [»] scaffold0393 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0393 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 13 - 298
Target Start/End: Complemental strand, 14773 - 14488
Alignment:
| Q |
13 |
aatatcattcagcaacagatgtgaacaaccagtagagaaggaatgaatgaaaagaatagatttcattgattattgaagctattacaagtgatacatatac |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14773 |
aatatcagtcagcaacagatgtgaacaaccagtagagaaggaatgaatgaaaagaatagatttcattgattattgaagctattacaagtgatacatatac |
14674 |
T |
|
| Q |
113 |
acgaactaatctatatgctagcttatcatatacatacgtacattggataactatctctaactgtcttggccgattactcgatgcgcaagtaattgatcct |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14673 |
acgaactaatctatgtgctagcttatcatatacatacatacattagataactatctctaactgtcttggccgattacttgatgcgcaagtaattgatcct |
14574 |
T |
|
| Q |
213 |
taactaactatacctatcatttggtacatgatgcaatatccccccacaaattggatgttggtaaatgtacaccatacccaactact |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14573 |
taactaactatacctatcatttggtacatgatgcaatatccccccacaaattggatgttggtaaatgtacaccatacccaactact |
14488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 295
Target Start/End: Original strand, 31482360 - 31482416
Alignment:
| Q |
239 |
catgatgcaatatccccccacaaattggatgttggtaaatgtacaccatacccaact |
295 |
Q |
| |
|
|||| |||||||||||||||||| ||||| | |||||||||| || |||||||||| |
|
|
| T |
31482360 |
catggtgcaatatccccccacaagttggagggtggtaaatgtctactatacccaact |
31482416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University