View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7036_low_16 (Length: 261)
Name: NF7036_low_16
Description: NF7036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7036_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 7705340 - 7705108
Alignment:
| Q |
1 |
tcacttatgtagtagcagaagcaaaaaagcagttaaatagtgcacctctagccattgtcttttttgtttgaagatgtcttgcaaaagtcaatgctcttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7705340 |
tcacttatgtagtagcagaagcaaaaaagtagttaaatagtgcacctctagccattgtcttttttgtttgaagatgtcttgcagaagtcaatgctcttgt |
7705241 |
T |
 |
| Q |
101 |
atgaatgagacttaagcttaagggatccacgacttatttttgtatgcatctctgaaaaacagactccgatgtccgaaacccgtacgaacgacatgtgtca |
200 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
7705240 |
atgaat-----ttaagcttaagggatctacaacttatttttgtatgcatctctgaaaaacagactccgatgtccgacacccgt----acgacatgtgtca |
7705150 |
T |
 |
| Q |
201 |
gacaagtgtcccaannnnnnnatatttttctaagcttcaaca |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7705149 |
gacaagtgtcccaatttttttatatttttctaagcttcaaca |
7705108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 112 - 153
Target Start/End: Complemental strand, 8149799 - 8149758
Alignment:
| Q |
112 |
ttaagcttaagggatccacgacttatttttgtatgcatctct |
153 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
8149799 |
ttaagcttaagggatccacaacttatttttgtatacatctct |
8149758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 188 - 242
Target Start/End: Complemental strand, 8149708 - 8149654
Alignment:
| Q |
188 |
acgacatgtgtcagacaagtgtcccaannnnnnnatatttttctaagcttcaaca |
242 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8149708 |
acgacacgtgtcagacaagtgtcccaatttttttatatttttctaagcttcaaca |
8149654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University