View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7038_high_12 (Length: 341)
Name: NF7038_high_12
Description: NF7038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7038_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 158 - 335
Target Start/End: Complemental strand, 26003608 - 26003431
Alignment:
| Q |
158 |
ggtaaataaaatagtgttataaattctaatgatgtttttaataatttcacaaactattttgcctatggaagtgtaatctcaacacttattgattactatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26003608 |
ggtaaataaaatagtgttataaattctaatgatgtttttaataatttcacaaactattttgcctatggaagtttaatctcaacacttattgattactatt |
26003509 |
T |
|
| Q |
258 |
tcacttttgattttaaaaatggtatgcgaacttattcaagtttggtcgcaatttcaaggattttgatgtctctgctac |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
26003508 |
tcacttttgattttaaaaatggtatgcgaacttattcaagtttggtcgcgatttcaaggatattgatgtctttgctac |
26003431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 26003749 - 26003675
Alignment:
| Q |
18 |
aaaaacggatctaattatgttgttaatcattgttcaagttgtatttttggattctgtatatctgctaaaaatgtg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26003749 |
aaaaacggatctaattatgttgttaatcattgttcaagttgtatttttggattctgtatatctgctaaaaatgtg |
26003675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University