View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7038_low_11 (Length: 387)
Name: NF7038_low_11
Description: NF7038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7038_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 219 - 369
Target Start/End: Complemental strand, 30309876 - 30309729
Alignment:
| Q |
219 |
gaaggtctccttttttatcccaaaatttgatttgatttgannnnnnnnnngttgaagaaaatccctaattcttctcagtcccgtccagttgcaccccgtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30309876 |
gaaggtctccttttttatcccaaaattt-atttgattt---attttttttgttgaagaaaatccctaattcttctcagtccggtccagttgcaccccgtt |
30309781 |
T |
 |
| Q |
319 |
ttctttctcac-aatacagagagaatctcttcttctcttagcccgccgccac |
369 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30309780 |
ttctttctcacaaaaacagagagaatctcttcttctcttagcccgccgccac |
30309729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 24 - 94
Target Start/End: Complemental strand, 30310568 - 30310498
Alignment:
| Q |
24 |
ggatttaaaaatgatgaatttttggttcgaaaatgatgatgaagaagataatttatttaatttttgtaatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30310568 |
ggatttaaaaatgatgaatttttggttcgaagatgatgatgaagaagataatttatttaatttttgtaatt |
30310498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 105 - 156
Target Start/End: Complemental strand, 30310446 - 30310395
Alignment:
| Q |
105 |
ttatcatgtcatatatattgtaacaagtgttacatcaaaaggttagcgtcgc |
156 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30310446 |
ttatcatatcatatttattgtaacaagcgttacatcaaaaggttagcgtcgc |
30310395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University