View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7040_high_3 (Length: 241)
Name: NF7040_high_3
Description: NF7040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7040_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 46195948 - 46196172
Alignment:
| Q |
1 |
acatctatgcttttggattgtaactagtctaagtttttggtttggaacctcttttaaggatagacacaattacagtttgatcattgataacgtgaaactt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
46195948 |
acatctatgtttttggattgtaactagtctaagtttttgatttggaacctcttttaaggatagacacaattacagtttaatcattgacaacgtgaaactt |
46196047 |
T |
 |
| Q |
101 |
taaacccactatgagtgaattatacaactgaccatatgggtgttgaaccagtaattatgttcgtatcttgttgggatttgcctagtgttttaccgtttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
46196048 |
taaacccactatgagtgaattatacaactgatcatatgggtgttgaaccagtaattatgttcgtatgttgttgggatttgcctagtgttttaccatttct |
46196147 |
T |
 |
| Q |
201 |
cgaagaagatagtcttagtaggaag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46196148 |
cgaagaagatagtcttagtaggaag |
46196172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University