View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7041_low_6 (Length: 242)
Name: NF7041_low_6
Description: NF7041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7041_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 100 - 236
Target Start/End: Complemental strand, 11799375 - 11799239
Alignment:
| Q |
100 |
atgtaggttggagcgagtaaatccacaatgccctattacttgcttaccattatccaagcccatagacaattgcctttctaaggtgataaaggtttcaagt |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11799375 |
atgtaggttggagcgagtaaatccagaatgccctattacttgcttaccattatccaagcctatagacaattgcctttccaaggtgataaaggtttcaagt |
11799276 |
T |
|
| Q |
200 |
gcatagttgttgaaagctgatttcagttggatgcatt |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11799275 |
gcatagttgttgaaagctgttttcagttggatgcatt |
11799239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 113 - 211
Target Start/End: Complemental strand, 11826144 - 11826046
Alignment:
| Q |
113 |
cgagtaaatccacaatgccctattacttgcttaccattatccaagcccatagacaattgcctttctaaggtgataaaggtttcaagtgcatagttgttg |
211 |
Q |
| |
|
|||||||||||| | || ||||||||| ||||||||| | | ||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
11826144 |
cgagtaaatccagattgtcctattactagcttaccatcaccaaagcccaaagacaattgccttgctaaggtgataaaggtttcaagtgcataattgttg |
11826046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 190
Target Start/End: Complemental strand, 11815265 - 11815194
Alignment:
| Q |
119 |
aatccacaatgccctattacttgcttaccattatccaagcccatagacaattgcctttctaaggtgataaag |
190 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||| ||| ||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11815265 |
aatccagaatgtcctatgacttgcttaccatcatcaaagcccatagacaattgccttgctagggtgataaag |
11815194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 11799460 - 11799419
Alignment:
| Q |
13 |
aatatttttagctaaaatgacacttaatttaaaatggaacaa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11799460 |
aatatttttagctaaaatgacacttaatttaaaatggaacaa |
11799419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 190
Target Start/End: Complemental strand, 124910 - 124821
Alignment:
| Q |
101 |
tgtaggttggagcgagtaaatccacaatgccctattacttgcttaccattatccaagcccatagacaattgcctttctaaggtgataaag |
190 |
Q |
| |
|
||||||||||||||| ||||||| |||| || |||||| | || |||| || ||||| ||||||||||| ||| ||||||| |||||| |
|
|
| T |
124910 |
tgtaggttggagcgaataaatcctgaatgtccaattactagtttcccatattctaagccaatagacaattgtcttgctaaggtcataaag |
124821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University