View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7042_high_7 (Length: 325)

Name: NF7042_high_7
Description: NF7042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7042_high_7
NF7042_high_7
[»] chr2 (1 HSPs)
chr2 (24-306)||(4569625-4569907)


Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 24 - 306
Target Start/End: Original strand, 4569625 - 4569907
Alignment:
24 gcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttgtaaacagtgagttgaagcatgcatggatggtt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569625 gcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttgtaaacagtgagttgaagcatgcatggatggtt 4569724  T
124 taatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569725 taatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacg 4569824  T
224 gtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgtggcggc 306  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4569825 gtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgtggcggc 4569907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University