View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7042_low_11 (Length: 325)
Name: NF7042_low_11
Description: NF7042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7042_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 24 - 306
Target Start/End: Original strand, 4569625 - 4569907
Alignment:
| Q |
24 |
gcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttgtaaacagtgagttgaagcatgcatggatggtt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569625 |
gcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttgtaaacagtgagttgaagcatgcatggatggtt |
4569724 |
T |
 |
| Q |
124 |
taatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569725 |
taatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcgaggtagtttacggattcgagagtgatgtctacg |
4569824 |
T |
 |
| Q |
224 |
gtggcgtgaatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgtggcggc |
306 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569825 |
gtggcgtggatgagaggaacgctgtcttggcttttggagcagaagagttcgaggcggtggttgtggtagcggagtgtggcggc |
4569907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University