View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7042_low_13 (Length: 282)
Name: NF7042_low_13
Description: NF7042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7042_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 37279667 - 37279918
Alignment:
| Q |
13 |
aatattaaaccaaacagacatagcattcggacagtcatggagtgcgtgcagcgacgtttccactgtacctttacacttcatacaaagagcatcaccaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37279667 |
aatattaaaccaaacagacatagcattcggacagtcatggagtgcgtgcagcgacgtttccactgtacctttacacttcatacaaagagcatcaccaaga |
37279766 |
T |
|
| Q |
113 |
tgcattctactcttgtggtaattggtaagcaacctaccatgtaacagctgccaagtgaaatatttaactcgttctgaggctgcaagtttccaaattcttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37279767 |
tgcattctactcttgtggtaattggtaagcaacctaccatgtaacagctgccaagtgaaatatttaactcgttctgaggctgcaagtttccaaattcttt |
37279866 |
T |
|
| Q |
213 |
cccgaactgcactcgtattgctttcttggacctcactaagcagatgatatgc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37279867 |
cccgaactgcactcgtattgctttcttggacctcactaagcagatgatatgc |
37279918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University