View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7042_low_14 (Length: 280)
Name: NF7042_low_14
Description: NF7042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7042_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 8 - 278
Target Start/End: Original strand, 36458711 - 36458981
Alignment:
| Q |
8 |
gccttgacgacgaagcaattcgatagagtctggattttgaagatcacgctccacgtcaaaatctttgaaattaaattcccaaatatagctgtatgcatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36458711 |
gccttgacgacgaagcaattcgatagagtctggattttgaagatcacggtccacgtcaaaatctttgaaattaaattcccaaatatagctgtatgcaaca |
36458810 |
T |
 |
| Q |
108 |
tctccaggtaggttaccatttgcatcagtgagagtaagacctagttgaatcaacttgagattatccacgttagccttcaagaaactgtactgttctgatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458811 |
tctccaggtaggttaccatttgcatcagtgagagtaagacctagttgaatcaagttgagattatccacgttagccttcaagaaactgtactgttctgatg |
36458910 |
T |
 |
| Q |
208 |
gatccatatggcggaggtgatacggtatattgggatcaaagttaggtgcaacgacgacaccacgaaactcg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36458911 |
gatccatatggcggaggtgatacggtatattgggatcaaagttaggtgcaacgacgacaccaggaaactcg |
36458981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University