View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7042_low_5 (Length: 401)
Name: NF7042_low_5
Description: NF7042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7042_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 82 - 395
Target Start/End: Original strand, 39963735 - 39964048
Alignment:
| Q |
82 |
gatgttttacccgttccaggaggtccatacaacagcagatggggtaatctattctcagtagtcaacctatcaactatacacacaaaaatcaacaaaaaat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963735 |
gatgttttacccgttccaggaggtccatacaacagcagatggggtaatctattctcagtagtcaacctatcaactatacacacaaaaatcaacaaaaaat |
39963834 |
T |
|
| Q |
182 |
aaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagctacttgtgtcaacgatgtcgcggtgagctgcaac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39963835 |
aaataacacaccaaaggaacgataaaccctagaaatgaaaggggaagttagagagggaaagggagttacttgtgtcaacgatgtcgcggtgagctgcaac |
39963934 |
T |
|
| Q |
282 |
gtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgacggttttgcccttgtctgta |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963935 |
gtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggttaccggcggcaatgacggttttgcccttgtctgtg |
39964034 |
T |
|
| Q |
382 |
acgttgatgtccat |
395 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
39964035 |
acgtcgatgtccat |
39964048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 39963727 - 39963641
Alignment:
| Q |
1 |
cttgcggtggcgcgaaaattatacggtgctcagtatcataatatgattttggaactcaatgcttcagatgatagaggaattgatgtt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963727 |
cttgcggtggcgcgaaaattatacggtgctcagtatcataatatgattttggaactcaatgcttcagatgatagaggaattgatgtt |
39963641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University