View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7043_high_14 (Length: 345)
Name: NF7043_high_14
Description: NF7043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7043_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 14381032 - 14381363
Alignment:
| Q |
1 |
gtggtactgtgctgtatccaaagccactgttactgttctcaattctccctttggtggcttccaatcctcccgcttaattttaccagaaaaatcattcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14381032 |
gtggtactgtgctgtatccaaagccactgttactgttctcaattctccctttggtggcttccaatcctcccgcttaattttaccagaaaaatcattcata |
14381131 |
T |
|
| Q |
101 |
agggtcccttcttcatcatgaatctcaataatttcacacccccgcacatactgtaggccaagcttctgtggcacactggctttgttttcttcttccgcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14381132 |
agggtcccttcttcatcatgaatctcaataatttcacacccccgcacatactgtaggccaagcttctgtggcacactggctttgttttcttcttctgcac |
14381231 |
T |
|
| Q |
201 |
taagaggctcaaatgatgggcgaatagttagtaaaaacaatacatcatgttcttttagtgcatcccattcagatctaatatgggatctatagctggaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14381232 |
taagaggctcaaatgatgggcgaatagttagtaaaaacaatacatcatgttcttttagtgcatcccattcagatctaatatgggatctatagctggaaat |
14381331 |
T |
|
| Q |
301 |
gctataggtaacctttgcagtcgcagatgatg |
332 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |
|
|
| T |
14381332 |
gctataggtaacttttgcagtcacagatgatg |
14381363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University