View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7043_high_23 (Length: 224)
Name: NF7043_high_23
Description: NF7043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7043_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 73 - 208
Target Start/End: Original strand, 11557637 - 11557772
Alignment:
| Q |
73 |
aaaagtgacggacgtgacggagagaggaacggtgtgtgacccagtttgtgtggttgtagagtgttctgnnnnnnngcattcctcgttcttggttttggtc |
172 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11557637 |
aaaagtgacgcacgtgacggagagaggaacggtgtgtgacccagtttgtgtggttgtagagtgttctgtttttttgcattcctcgttcttggttttggtc |
11557736 |
T |
 |
| Q |
173 |
tgcccagtctgggattgtacggaggagggtgattat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11557737 |
tgcccagtctgggattgtacggaggagggtgattat |
11557772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University