View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7043_low_16 (Length: 317)
Name: NF7043_low_16
Description: NF7043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7043_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 310
Target Start/End: Original strand, 6476280 - 6476566
Alignment:
| Q |
19 |
gaagtgattaattatagggagaagattctggaatttt-cgagaatcggtggagattgttcgaatttgaagaaactcgccggcgcgggaaagtcgccggag |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6476280 |
gaagtgattgattatagggagaagattctggaatttttcgagaattggtggagattgttcgaatttgaagaaactcgccgacgcgggaaagtcgccggag |
6476379 |
T |
 |
| Q |
118 |
gagatttctgatatctctgagtcttgcgctcagatgatttttcagttgcataatcatgttgaggtaactttgaaatgaaatttaccgcgnnnnnnnacta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6476380 |
gagatttctgatatctctgagtcttgcgctcagatgatttttcagttgcataatcatgttgaggtaactttgaaatgaaatttaccgcgtttttttacta |
6476479 |
T |
 |
| Q |
218 |
gttaccgcgaataataattaatctcggttaaatatgaaacgctttatctttatcgtattcgtaactgaagaattactgttaaccttcttctca |
310 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476480 |
gttaccgcgaataataattaatcacggttaaatatgaaacg------ctttatcgtattcgtaactgaagaattactgttaaccttcttctca |
6476566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University