View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7043_low_22 (Length: 239)
Name: NF7043_low_22
Description: NF7043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7043_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 33249354 - 33249583
Alignment:
| Q |
2 |
tgtttctcagtttgaatcattgtatttgtatcagaaacttgtcttatagattcgaagtcaattttgttgagtagatcattttcagctttatctataaaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33249354 |
tgtttctcagtttgaatcattgtatttgtatcagaaacttgtcttatagattcgaagtcaattttgttgagtagatcattttcagctttatctataaaga |
33249453 |
T |
 |
| Q |
102 |
aaatgataagttcacttctgtaccttctatcaaaaaattggagtcttaaaccttgaaccctagcatctctatcaaattctctatttaagaggagactaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33249454 |
aaatgataagttcacttctgtaccttctatcaaaaaattggagtcttaaaccttgaaccctaccatctctatcaaattctctatttaagaggagattaac |
33249553 |
T |
 |
| Q |
202 |
aaaagagctttcaatgatgtatttcacttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33249554 |
aaaagagctttcaatgatgtatttcacttg |
33249583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University