View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7043_low_24 (Length: 224)

Name: NF7043_low_24
Description: NF7043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7043_low_24
NF7043_low_24
[»] chr8 (1 HSPs)
chr8 (73-208)||(11557637-11557772)


Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 73 - 208
Target Start/End: Original strand, 11557637 - 11557772
Alignment:
73 aaaagtgacggacgtgacggagagaggaacggtgtgtgacccagtttgtgtggttgtagagtgttctgnnnnnnngcattcctcgttcttggttttggtc 172  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||    
11557637 aaaagtgacgcacgtgacggagagaggaacggtgtgtgacccagtttgtgtggttgtagagtgttctgtttttttgcattcctcgttcttggttttggtc 11557736  T
173 tgcccagtctgggattgtacggaggagggtgattat 208  Q
    ||||||||||||||||||||||||||||||||||||    
11557737 tgcccagtctgggattgtacggaggagggtgattat 11557772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University