View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7044_high_6 (Length: 244)
Name: NF7044_high_6
Description: NF7044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7044_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 27658140 - 27658280
Alignment:
| Q |
19 |
acgatagggacactgtttt-attaatattaataaattgattttacttttttatgaatgctattttgtgtgtgcgtttaagtactatgtatttgatcttgt |
117 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27658140 |
acgatagggacattgtttttattaatattaataaattgattttacttttttatgaatgctattttgtgtgtgcgtttaagtactatgtatttgatcttct |
27658239 |
T |
 |
| Q |
118 |
aacaatactaaggatactaagaagtaatataaattcacatt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27658240 |
aacaatactaaggatactaagaagtaatataaattaacatt |
27658280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 154 - 225
Target Start/End: Original strand, 27658307 - 27658378
Alignment:
| Q |
154 |
acattttacaggcttttacattcagttctccagctgatggtcctcttcgtaaggatgcaccaacatggtgtc |
225 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27658307 |
acattttacaggcttgcacattcagttctccagctgatggtcctcttcgtaaggatgcaccaacatggtgtc |
27658378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University