View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7044_high_9 (Length: 209)
Name: NF7044_high_9
Description: NF7044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7044_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 1079812 - 1079621
Alignment:
| Q |
20 |
ctgatccactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacaccaaggcatcgggatcac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079812 |
ctgatccactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacaccaaggcatcgggatcac |
1079713 |
T |
|
| Q |
120 |
cttggactcaccagtttgttctgaa---------------agtaatttccggctcaactgattgaatttgtaaccggtcactctatacacag |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079712 |
cttggactcaccagtttgttctgaattcaatttggcgtccggtaatttccggctcaactgattgaatttgtaaccggtcactctatacacag |
1079621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University