View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7045_high_11 (Length: 238)

Name: NF7045_high_11
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7045_high_11
NF7045_high_11
[»] chr5 (2 HSPs)
chr5 (42-110)||(28470188-28470256)
chr5 (1-36)||(28470282-28470317)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 28470256 - 28470188
Alignment:
42 gagatgtatatgattcaattttaagatgcttttaatgatgtttctcttgatttatatgaaaactttaca 110  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||    
28470256 gagatgtatataattcaattttaagatgcttataatgatgtttctcttgatttatacgaaaactttaca 28470188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 28470317 - 28470282
Alignment:
1 acaagatgtcctagaaaagttgaagggtaaaaaagt 36  Q
    ||||||||||||||||||||||||||||||||||||    
28470317 acaagatgtcctagaaaagttgaagggtaaaaaagt 28470282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University