View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7045_high_2 (Length: 450)
Name: NF7045_high_2
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7045_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 184 - 444
Target Start/End: Complemental strand, 56485508 - 56485248
Alignment:
| Q |
184 |
tatataggctcccattggttatcgtctatggcgccatgttcgtgaagaagctgccaaaggaagggtacttaatcttataccttcttttcatctctatata |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485508 |
tatataggctcccattggttatcgtctatggcgccatgttcgtgaagaagcttccaaaggaagggtacttaatcttataccttcttttcatctctatata |
56485409 |
T |
 |
| Q |
284 |
tcttatgatatctaaccattattctttttgcttttctttctcagattggaatgattgatccttttgctaagcgtcatgtaacttcttctcatggcgttcc |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485408 |
tcttatgatatctaaccattattctttttgcttttctttctcagattggaatgattgatccttttgctaagcgtcatgtaacttcttctcatggcgttcc |
56485309 |
T |
 |
| Q |
384 |
tttaggtggtgttgggtgggtcttctcttcactctcttttctaatatttccttcatctcac |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56485308 |
tttaggtggtgttgggtgggtcttctcttcactctcttttctaatatttccttcatttcac |
56485248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 56485673 - 56485568
Alignment:
| Q |
19 |
gaaacctccacaacttacatggcagcgcaaattaaacaatcatgcaaatgcaaatgttccatcagaattcaccttatctttcaaagagatgattcatctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485673 |
gaaacctccacaacttacatggcagcgcaaattaaacaatcatgcaaattcaaatgttccatcagaattcaccttatctttcaaagagatgattcatctt |
56485574 |
T |
 |
| Q |
119 |
gtacgt |
124 |
Q |
| |
|
|||||| |
|
|
| T |
56485573 |
gtacgt |
56485568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University