View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7045_low_13 (Length: 290)
Name: NF7045_low_13
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7045_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 4669830 - 4670066
Alignment:
| Q |
19 |
gatctgatgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggccggttcatcatccataccatcttctggtacccctat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
4669830 |
gatctgatgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggctggttcatcatccataccatcttttggtacccctat |
4669929 |
T |
|
| Q |
119 |
aactttttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatgtgtagacccaccatgtattgcact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4669930 |
aactttttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatatgtagacccaccatgtattgcact |
4670029 |
T |
|
| Q |
219 |
tggtaccactgtccctttatccctacacgaccaacaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4670030 |
tggtaccactgtccctttatccctacacgaccaacaa |
4670066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 263
Target Start/End: Original strand, 10872953 - 10873093
Alignment:
| Q |
128 |
tttctcttttgaaggagctcattctttcatcacatggttgtag--------catccccaatgcatacaaattatgtgtagacccaccatgtattgcactt |
219 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||| ||||| |||| |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
10872953 |
tttctcttttgaaggagcacactctttcatcacatggtcgtagactcatagcatccacaatacatacaaattatgtgtagaccctc---gtattgcactt |
10873049 |
T |
|
| Q |
220 |
ggtaccactgtccctttatccctacacgaccaacaatcgtcttt |
263 |
Q |
| |
|
||||| ||| ||| |||||||| |||| ||||||||| |||||| |
|
|
| T |
10873050 |
ggtactactctccatttatccccacacaaccaacaatagtcttt |
10873093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University