View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7045_low_17 (Length: 238)
Name: NF7045_low_17
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7045_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 28470256 - 28470188
Alignment:
| Q |
42 |
gagatgtatatgattcaattttaagatgcttttaatgatgtttctcttgatttatatgaaaactttaca |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28470256 |
gagatgtatataattcaattttaagatgcttataatgatgtttctcttgatttatacgaaaactttaca |
28470188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 28470317 - 28470282
Alignment:
| Q |
1 |
acaagatgtcctagaaaagttgaagggtaaaaaagt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28470317 |
acaagatgtcctagaaaagttgaagggtaaaaaagt |
28470282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University