View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7045_low_21 (Length: 218)
Name: NF7045_low_21
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7045_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 4847415 - 4847260
Alignment:
| Q |
17 |
atcagctcatggtgcggctccgtttggtataaacaatgtacatagatgnnnnnnnnnnnactaaagataatttaattcatttcattcattgtaatggtaa |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
4847415 |
atcagctcatggtgcggctccgtctggtataaacaatgtacatagatgttttttttt--actaaagataatttaattcatttcattcatagtaatagtaa |
4847318 |
T |
|
| Q |
117 |
tagtacgaatacatcaaggtatataaatgtaaatatgaaaactagctaaagatgtgac |
174 |
Q |
| |
|
|||||| ||| || |||||| |||| || |||||| |||||||| ||||||| |||| |
|
|
| T |
4847317 |
tagtaccaatgcacgaaggtacataagtgaaaatataaaaactaggtaaagatatgac |
4847260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University