View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7045_low_21 (Length: 218)

Name: NF7045_low_21
Description: NF7045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7045_low_21
NF7045_low_21
[»] chr6 (1 HSPs)
chr6 (17-174)||(4847260-4847415)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 4847415 - 4847260
Alignment:
17 atcagctcatggtgcggctccgtttggtataaacaatgtacatagatgnnnnnnnnnnnactaaagataatttaattcatttcattcattgtaatggtaa 116  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||           |||||||||||||||||||||||||||||| ||||| ||||    
4847415 atcagctcatggtgcggctccgtctggtataaacaatgtacatagatgttttttttt--actaaagataatttaattcatttcattcatagtaatagtaa 4847318  T
117 tagtacgaatacatcaaggtatataaatgtaaatatgaaaactagctaaagatgtgac 174  Q
    |||||| ||| ||  |||||| |||| || |||||| |||||||| ||||||| ||||    
4847317 tagtaccaatgcacgaaggtacataagtgaaaatataaaaactaggtaaagatatgac 4847260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University