View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7046_low_2 (Length: 268)
Name: NF7046_low_2
Description: NF7046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7046_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 42894021 - 42893881
Alignment:
| Q |
9 |
tcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccacttccgtttcttctactcatcttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42894021 |
tcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccacttccgtttcttctactcatcttc |
42893922 |
T |
|
| Q |
109 |
ttcctctgttttcctctgtcttctacaaaatacataataat |
149 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42893921 |
ttcctctgttttcctctgttttctacaaaatacataataat |
42893881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University