View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7047_low_6 (Length: 246)
Name: NF7047_low_6
Description: NF7047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7047_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 34986310 - 34986098
Alignment:
| Q |
20 |
tgtcatgtacgattgattaggcttgcggttgattttatggattgtaactggatgtgaagggtgtggtttgcttcttctcttaatgttttctctttgaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34986310 |
tgtcatgtacgattgattaggcttgcggttgattttatggattgtaactggatgtgaagggtgtggtttgcttcttctcttaatgttttctctttgaaca |
34986211 |
T |
 |
| Q |
120 |
agcggattgtcaatgaaccggagcatgtgactaaatcagtcctataataggaacaagagatgctttgaaggatatgatattcctgatgcggctgatatgg |
219 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34986210 |
agtggattgtcaatgaaccggagcatgtgactaaatcagtcctataataggaacaagagatgctttgaaggatatgatattcctggtgcggctgatatgg |
34986111 |
T |
 |
| Q |
220 |
tgttctgagcaca |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34986110 |
tgttctgagcaca |
34986098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 25 - 232
Target Start/End: Complemental strand, 34993123 - 34992917
Alignment:
| Q |
25 |
tgtacgattgattaggcttgcggttgattttatggattgtaactggatgtgaagggtgtggtttgcttcttctcttaatgttttctctttgaacaagcgg |
124 |
Q |
| |
|
||||| ||||||||| || ||||| ||||||||||||||||| ||| | |||||||||||| |||||||||||||||||||| ||| ||||||||| | |
|
|
| T |
34993123 |
tgtacaattgattagactcccggttaattttatggattgtaaccggacgagaagggtgtggtctgcttcttctcttaatgtttgctcattgaacaagtg- |
34993025 |
T |
 |
| Q |
125 |
attgtcaatgaaccggagcatgtgactaaatcagtcctataataggaacaagagatgctttgaaggatatgatattcctgatgcggctgatatggtgttc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34993024 |
attgtcaatgaaccggagcatgtgactaaatcagtcctataataggaacaagagatgctttgaaggatatgatattcctggtgcggctgatatggtgttc |
34992925 |
T |
 |
| Q |
225 |
tgagcaca |
232 |
Q |
| |
|
|||||||| |
|
|
| T |
34992924 |
tgagcaca |
34992917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University