View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7050_high_7 (Length: 221)
Name: NF7050_high_7
Description: NF7050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7050_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 2515676 - 2515464
Alignment:
| Q |
1 |
agttagcctaaatgaggagaattgtagcagccagcaggaaccattaaagcaaatggattggatgatttttatgttcagtggatgaattgaattagattat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2515676 |
agttagcctaaatgaggagaaatgtagcagccagcaggaaccattaaagcaaatggattggatgatttttatgttcagtggatgaattgaattagattat |
2515577 |
T |
|
| Q |
101 |
tttaaacaaattttagtggatttttaatggatcaatgaattgttttaatctcttagttcaaatccattcaatttatcaattttgtcacccctacttgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2515576 |
tttaaacaaattttagtggatttttaatggatcaatgaattgttttaatctcttagttcaaatccattcaatttatcaattttgtcacccctatttgcaa |
2515477 |
T |
|
| Q |
201 |
ctaaatgatgatg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2515476 |
ctaaatgatgatg |
2515464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 146
Target Start/End: Complemental strand, 14664653 - 14664618
Alignment:
| Q |
111 |
ttttagtggatttttaatggatcaatgaattgtttt |
146 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14664653 |
ttttagtggatttttaatggattaatgaattgtttt |
14664618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University