View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7051_high_7 (Length: 366)
Name: NF7051_high_7
Description: NF7051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7051_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 8 - 349
Target Start/End: Complemental strand, 52558296 - 52557955
Alignment:
| Q |
8 |
tgaaatgaaacgataaatatataatgattgtaatatttacgatgatgaagtaggctacgtatggggtttgtaaatcactcttgtacacgtttgaggcttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52558296 |
tgaaatgaaacgataaatatataatgattgtaatatttacgatgatgaagtaggctacgtatggggtttgtaaatcactcttgtacacgtttgaggcttg |
52558197 |
T |
|
| Q |
108 |
tggcaatgctgtctctgacaatgacttggtgagaaaattataatgtaatttctgtctgtaatatagagtaagtccaaaattatagtacttttcaaaattg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52558196 |
tggcaatgctgtctctgacaatgacttggtgagaaaattataatgtaatttctgtctgtaatatagagtaagtccaaaattatagtacttttcaaaattg |
52558097 |
T |
|
| Q |
208 |
gggcaaaggggccattgcttttaagctacatgccagtttatttttctttcaattacagaatgcccatggcccctcaatatatccctatagatctgaatgt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52558096 |
gggcaaaggggccattgcttttaagctacatgccagtttatttttctttcaattacagaatgcccatggcccctcaatatatccctatagatctgaatgt |
52557997 |
T |
|
| Q |
308 |
gttatggtgggtacagaatttttatgggcaagggtaaggctg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52557996 |
gttatggtgggtacagaatttttatgggcaagggtaaggctg |
52557955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University