View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7051_low_10 (Length: 314)
Name: NF7051_low_10
Description: NF7051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7051_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 45626004 - 45625698
Alignment:
| Q |
1 |
atatggtcagaagcagatatgagcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626004 |
atatggtcagaagcagatatgagcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtcctt |
45625905 |
T |
 |
| Q |
101 |
gcaggtgagccgggaacaccgccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatcc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625904 |
gcaggtgagccgggaacatcgccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatcc |
45625805 |
T |
 |
| Q |
201 |
ctcacgttcaatgttgagtgcttcctggggttcattcttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactc |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625804 |
ctcacgttcaatgttgattgcttcctggggttcattcttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactc |
45625705 |
T |
 |
| Q |
301 |
tctgctt |
307 |
Q |
| |
|
||||||| |
|
|
| T |
45625704 |
tctgctt |
45625698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University