View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7051_low_19 (Length: 245)
Name: NF7051_low_19
Description: NF7051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7051_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 42 - 226
Target Start/End: Original strand, 35005519 - 35005703
Alignment:
| Q |
42 |
catttggttgatagggtccaattcctgttcggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005519 |
catttggttgatagggtccaattcctgttcggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattct |
35005618 |
T |
 |
| Q |
142 |
ttgttggcgcgagtagggttttgtgtgctgggcatagatgcatttgatctgtgctttgtgcgtttgggtgggccctagatttctg |
226 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005619 |
ttgttggcacgagtagggttttgtgtgctgggcatagatggatttgatctgtgctttgtgcgtttgggtgggccctagatttctg |
35005703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 157
Target Start/End: Original strand, 8766105 - 8766190
Alignment:
| Q |
72 |
ggaagtggttctttgctaaacacactcaataccactgttctctttatgagtggaaggtggagccgattctttgttggcgcgagtag |
157 |
Q |
| |
|
|||| |||||| ||||||||||| || | || | ||||| |||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
8766105 |
ggaattggttcattgctaaacacccttcacactagtgttcattttatgagtggaaggtggagtcaattctttgttggcgccagtag |
8766190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 146
Target Start/End: Original strand, 9500222 - 9500254
Alignment:
| Q |
114 |
tttatgagtggaaggtggagccgattctttgtt |
146 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
9500222 |
tttatgagtggaaggtggagccaattctttgtt |
9500254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University