View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7051_low_22 (Length: 241)
Name: NF7051_low_22
Description: NF7051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7051_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 45626160 - 45626359
Alignment:
| Q |
1 |
atatagctttcgaatagtatagtcatgtatgttaatattgttagatgcgcatatctat----cttttgtagtttccgcgttcagtgtccaaaatcaagat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626160 |
atatagctttcgaatagtatagtcatgtatgttaatattgttagatgcgcatatctatatatcttttgtagtttccgcgttcagtgtccaaaatcaagat |
45626259 |
T |
 |
| Q |
97 |
attgagtgtaagactccttcttttcatttaatccgttattataactcaatatcatactagtcatccactcttaagttaaaacataattttctgctcttaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
45626260 |
attgagtgtaagactccttcttttcatttaatccgttattataactcaatatcatactagtcatccactcttaagttacaacataattttcttctcttaa |
45626359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University