View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7053_high_5 (Length: 380)
Name: NF7053_high_5
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7053_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 1079594 - 1079408
Alignment:
| Q |
1 |
ctttcatcggccataattcagttttcacttatctttcaagatttctatcaattcatagaaaaaatgagtattaaactattaatcatttgcgatgttcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1079594 |
ctttcatcggccataattcagttttcacttatctttcacgatttctatcaattcatagaaaaaatgagtattaaactattaatcatttgcaatgttcaga |
1079495 |
T |
|
| Q |
101 |
agnnnnnnncacatgcaaagatgtttcagaattcaatcaaaagaatatacatctagtaatcagtttcataaacatcttctatcatag |
187 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079494 |
agaaaaaaacacatgcaaagatgattcagaattcaatcaaaagaatatacatctagtaatcagtttcataaacatcttctatcatag |
1079408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 287 - 364
Target Start/End: Complemental strand, 1079318 - 1079246
Alignment:
| Q |
287 |
gtacatgcagagtcacacctgacctgatggatggatttgcagcgatgactgatgatgggtaatgctgatgttgatgtt |
364 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079318 |
gtacatgcagagtcacacctga-----tggatggatttgcagcgatgactgatgatgggtaatgctgatgttgatgtt |
1079246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University