View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7053_low_14 (Length: 380)

Name: NF7053_low_14
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7053_low_14
NF7053_low_14
[»] chr2 (2 HSPs)
chr2 (1-187)||(1079408-1079594)
chr2 (287-364)||(1079246-1079318)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 1079594 - 1079408
Alignment:
1 ctttcatcggccataattcagttttcacttatctttcaagatttctatcaattcatagaaaaaatgagtattaaactattaatcatttgcgatgttcaga 100  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
1079594 ctttcatcggccataattcagttttcacttatctttcacgatttctatcaattcatagaaaaaatgagtattaaactattaatcatttgcaatgttcaga 1079495  T
101 agnnnnnnncacatgcaaagatgtttcagaattcaatcaaaagaatatacatctagtaatcagtttcataaacatcttctatcatag 187  Q
    ||       |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1079494 agaaaaaaacacatgcaaagatgattcagaattcaatcaaaagaatatacatctagtaatcagtttcataaacatcttctatcatag 1079408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 287 - 364
Target Start/End: Complemental strand, 1079318 - 1079246
Alignment:
287 gtacatgcagagtcacacctgacctgatggatggatttgcagcgatgactgatgatgggtaatgctgatgttgatgtt 364  Q
    ||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||    
1079318 gtacatgcagagtcacacctga-----tggatggatttgcagcgatgactgatgatgggtaatgctgatgttgatgtt 1079246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University