View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7053_low_18 (Length: 325)
Name: NF7053_low_18
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7053_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 12416568 - 12416355
Alignment:
| Q |
8 |
gagatggacatcacatccaatagttcttatgattatggtttcaaatccgagaatgtttcaaatgctaaccctacaactgtacggcagttggtgaaatttc |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12416568 |
gagatggacatagcatccaatagttcttattcttatgatttcaaatccgagaatgtttcaaatgcttaccctacaactgtacagcagttggtgaaatttc |
12416469 |
T |
|
| Q |
108 |
actattcagttatggcaaaaaaccaagtttctgaaagaattttacctacaattcctggaatatgaattgtctatgacttcacttttctgtgacctagttc |
207 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12416468 |
acttttcagctatggcaaaaaaccaagtttctgaaagaattttaactacaattcctggaatatgaattatctatgacttcacttttctgtgacctagttc |
12416369 |
T |
|
| Q |
208 |
cttgctgaagactt |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12416368 |
cttgctgaagactt |
12416355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 12428628 - 12428415
Alignment:
| Q |
8 |
gagatggacatcacatccaatagttcttatgattatggtttcaaatccgagaatgtttcaaatgctaaccctacaactgtacggcagttggtgaaatttc |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12428628 |
gagatggacatagcatccaatagttcttattcttatgatttcaaatccgagaatgtttcaaatgcttaccctacaactgtacagcagttggtgaaatttc |
12428529 |
T |
|
| Q |
108 |
actattcagttatggcaaaaaaccaagtttctgaaagaattttacctacaattcctggaatatgaattgtctatgacttcacttttctgtgacctagttc |
207 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12428528 |
acttttcagctatggcaaaaaaccaagtttctgaaagaattttaactacaattcctggaatatgaattatctatgacttcacttttctgtgacctagttc |
12428429 |
T |
|
| Q |
208 |
cttgctgaagactt |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12428428 |
cttgctgaagactt |
12428415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University