View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7053_low_24 (Length: 249)
Name: NF7053_low_24
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7053_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 231
Target Start/End: Complemental strand, 45587752 - 45587527
Alignment:
| Q |
6 |
gtttcgtgttgtaacatgatttctgcttatttaaatgttggaagttatatgcaaagtttgtatctttttagacgaatgttgtttgttgaaggaataaaac |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587752 |
gtttcgtggtgtaacatgatttctgcttatttaaatgttggaagttatatgcaaagtttgtatctttttagacgaatgttgtttgttgaaggaataaaac |
45587653 |
T |
 |
| Q |
106 |
cggatcaggtgattgcttgtttggttttatcaggatgcgctcacgtggagtgtcatggattgttaggtggaaaatcagttcatggttacattgtgaaaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587652 |
cggatcaggtgattgcttgtttggttttatcaggatgcgctcacgtggagcgtcatggattgttaggtggaaaatcagttcatggttacattgtgaaaaa |
45587553 |
T |
 |
| Q |
206 |
tgggtgggagttgaatgtggagatag |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45587552 |
tgggtgggagttgaatgtggagatag |
45587527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University