View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7053_low_33 (Length: 217)
Name: NF7053_low_33
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7053_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 23 - 177
Target Start/End: Original strand, 30150813 - 30150969
Alignment:
| Q |
23 |
aacattcactataagttgcaagaaatcatgtagttaatttgatttctgaagaaatagtataaggnnnnnnn--gtcattggcatttgagaattggactat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30150813 |
aacattcactataagttgcaagaaatcatgtagttaatttgatttctgaagaaatagtataaggttgttttttgtcattggcatttgagaattggactat |
30150912 |
T |
|
| Q |
121 |
ccttttcaagacaacgctgaatataatcatggtactctttggatttgcagctgatgt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30150913 |
ccttttcaagacaacgctgaatataatcatggtactctttggatttgcagcttatgt |
30150969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 32 - 73
Target Start/End: Complemental strand, 42320551 - 42320510
Alignment:
| Q |
32 |
tataagttgcaagaaatcatgtagttaatttgatttctgaag |
73 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
42320551 |
tataagttgcacgaaaacatggagttaatttgatttctgaag |
42320510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University