View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7053_low_34 (Length: 214)
Name: NF7053_low_34
Description: NF7053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7053_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 36605429 - 36605246
Alignment:
| Q |
19 |
ttttagttgataattttcatgtattgtgttatcatggggttccgaggaatcgaatggcgaagatttatacagaagcaagagaaatttttgggtatggaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605429 |
ttttagttgataattttcatgtattgtgttatcatggggttccgaggaatcgaatggcgaagatttatacagaagcaagagaaatttttgggtatggaaa |
36605330 |
T |
|
| Q |
119 |
tggagttttggaaaagaaatttcatgcttatgaagatttgggtttgagtaaatcatctcttatcaagctttttgtttgatgtcc |
202 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36605329 |
tggagttttggaaaagaaatttcaagcttatgaagatttgggtttgagtaaatcatctcttatcaagctttttgtttgttgtcc |
36605246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University