View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7054_high_5 (Length: 249)

Name: NF7054_high_5
Description: NF7054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7054_high_5
NF7054_high_5
[»] chr1 (1 HSPs)
chr1 (1-246)||(33306736-33306981)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 33306736 - 33306981
Alignment:
1 ctcccaccttggatgtttctcgccggtaatgcgaggcggcagcaacggcagtcaaaccggctaaggaggcagccagcgtgaagcggatggctttaccaat 100  Q
    |||||||||||||||||| ||||||||||||||||||||  || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33306736 ctcccaccttggatgtttgtcgccggtaatgcgaggcggtggccacggcagtcaaaccggctaaggaggcagccagcgtgaagcggatggctttaccaat 33306835  T
101 agaaccatctaaataacaaagaatgttgtagtttagtcatgttacaaatatagttacatatacttgatttattaaccaaattgaacttatgcttatttat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
33306836 agaaccatctaaataacaaagaatgttgtagtttagtcatgttacaaagatagttacatatacttgatttattaaccaaattgaacttatgcttatttat 33306935  T
201 aatgaataggnnnnnnnnntttaccttgctccatattgttggagat 246  Q
    ||||||||||         ||||||||||||||| |||||||||||    
33306936 aatgaataggaaaaaaaaatttaccttgctccatcttgttggagat 33306981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University